rs16859448 chr2:218980333 G>T
- Sequence
agagaccccttcttctgcaaatga[G/T]gaggccgagcagaagaaagacggc
- ASB in cell types
- glioblastoma cells GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | -2.65 | 1.77 | 1.50 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | -0.72 | 0.78 | 1.00 |
Items per page:
1 – 2 of 2