rs16863993 chr3:152183721 G>A
- Sequence
gggcctatagcagcatcaggaaat[G/A]aactgggttatccatttctttatc
- ASB in cell types
- MS-1 (Small cell lung carcinoma) GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | 0.67 | -0.34 | 1.00 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | -0.70 | 0.62 | 1.17 |
Items per page:
1 – 2 of 2