rs16871226 chr6:32948074 A>G
- Sequence
cagttcactcaggccaaggaacag[A/G]ttgtcaggaaagacatgtgaattc
- ASB in cell types
- HMEC (human mammary epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HMEC (human mammary epithelial cells) | 1.74 | 0.22 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, major depressive disorder (narrow definition), major depressive disorder (narrow definition) (females), rheumatoid arthritis
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood