Attention! You are using release Bill Cipher. You can switch to the latest ADASTRA version: adastra.autosome.org

rs169082 chr5:169647052 C>T

Sequence
cagcagagagcaccattattagta[C/T]taatgtccccattggacaggttgg
ASB in cell types
GM12878 (female B-cells lymphoblastoid cell line)

Color scale

color scale ref
-log10 FDR of Ref (C) ASB
color scale alt
-log10 FDR of Alt (T) ASB

Details

Cell type
Effect size Ref
Effect size Alt
FDR Ref
FDR Alt
Mean BAD
GM12878 (female B-cells lymphoblastoid cell line) 0.91 0.49 0.030.87 1.12
Items per page:
1 – 1 of 1

Motif analysis

No data available

Genetic associations

EMBL-EBI protein quantitative trait loci
GRASP arthritis including non-rheumatoid leptin neuroblastoma (brain cancer) paternal transmission distortion salmonella-induced pyroptosis transmission distortion
PheWAS abnormal tumor markers, elevated cea or ca 125 alcoholic liver damage aneurysm of other specified artery anticoagulants causing adverse effects aseptic necrosis of bone atrophic gastritis benign neoplasm of lip, oral cavity, and pharynx breast conditions, congenital or relating to hormones cardiac complications, not elsewhere classified cervical radiculitis chorioretinal scars congenital anomalies of limbs congenital deformities of feet congenital pigmentary anomalies of skin cornea replaced by transplant corneal dystrophy diplopia and disorders of binocular vision diseases of the jaws endometrial hyperplasia extrinsic allergic alveolitis flat foot gastrointestinal complications heartburn infection/inflammation of internal prosthetic device, implant or graft infections involving bone inflammatory disease of cervix, vagina, and vulva intracranial hemorrhage jaw disease nos kidney replaced by transpant kyphosis (acquired) lipoid metabolism disorder nos liver replaced by transplant male genital disorders morbid obesity multiple myeloma neoplasm of unspecified nature of digestive system occlusion of cerebral arteries, with cerebral infarction open wound of nose and sinus orthostatic hypotension osteomyelitis other cerebral degenerations other disorders of tympanic membrane other disorders of urethra and urinary tract other specified osteoporosis paraproteinemia perforation of tympanic membrane periostitis poisoning by agents primarily affecting blood constituents postmenopausal atrophic vaginitis postoperative infection posttraumatic wound infection pulmonary congestion and hypostasis pyogenic arthritis renal colic retinal detachments and defects secondary malignancy of lymph nodes swelling of limb symptoms involving head and neck temporomandibular joint disorders tinnitus toxic erythema unspecified erythematous condition unspecified osteomyelitis urethral stricture (not specified as infectious) ventral hernia

Download