rs16947926 chr17:13460344 G>C
- Sequence
ccctccccatgtgcttcaagtact[G/C]tgatataataaggctacaggcaac
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TTC-1240 (Rhabdoid tumor of the kidney) | 0.64 | 1.14 | 1.12 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting blood glucose, homa-b, irritible bowel syndrome, ldl cholesterol, microalbuminuria, neuroticism, urinary albumin-to-creatinine ratio