rs16983290 chr20:62847542 G>A
- Sequence
gaccaaggagctcaggtggccaga[G/A]gtaaggaggcataaactcattagg
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) GM19240 (B cells Lymphoblastoid Cell Lines) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | n/a | 3.30 | 1.33 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | -1.88 | 2.05 | 1.33 | |||
| foreskin keratinocyte | 1.43 | -0.86 | 2.33 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, chronic kidney disease
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid