rs169883 chr5:95698137 T>C
- Sequence
tacataatagagtgcttgggactt[T/C]catttgggaaaatcactgtgggaa
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | -1.09 | 1.60 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, fasting blood glucose, ldl cholesterol, obsessive-compulsive disorder (ocd), serum creatinine, triglycerides, waist hip ratio