rs17006888 chr4:83582222 C>T
- Sequence
taagagctgaccagaacccactgc[C/T]tttctttgccagtccatagcactt
- ASB in cell types
- MDM(monocyte derived macrophages) CD14+ monocytes MS-1 (Small cell lung carcinoma)
- ASB for transcription factors
- STAT1_HUMAN SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 3.20 | n/a | 2.00 | n/a | No Hit | |||
| SPI1_HUMAN | 2.20 | 0.25 | 2.10 | -2.27 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
