rs170142 chr21:36429792 C>G
- Sequence
ggtgggaggatcatctgagcccag[C/G]gaggttgaggctgcagtgagccga
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.93 | 0.80 | 1.03 | |||
| HEK293 (embryonic kidney) | 0.35 | 0.89 | 3.36 |
Items per page:
1 – 2 of 2