rs17020511 chr12:92574581 C>G
- Sequence
gcggctatctagcactatcagctt[C/G]taccaggagatggcctcttgccca
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM19238 (female B-cells lymphoblastoid cell lines) GM02630 (Fanconi anemi)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 3.05 | -1.93 | 1.11 | -0.86 | Weak Concordant | |||
| STAG1_HUMAN | 2.23 | -1.75 | 1.11 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
