rs1702312 chr1:25038161 T>C
- Sequence
cactcagcactggtgatgctccac[T/C]tcttttaggccacaccatcctatg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM12891 (male B- cells lymphoblastoid cell line)
- ASB for transcription factors
- IKZF1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | -0.68 | 1.95 | 1.00 | n/a | No Hit | |||
| CTCF_HUMAN | 0.45 | 1.03 | 1.20 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP autism with low iq, hypertension (early onset hypertension), late onset alzheimers disease, resistance to kuru in aged women despite likely exposure, sporadic creutzfeldt-jakob disease, tetrology of fallot