rs17024965 chr4:95985497 T>C
- Sequence
aggaatcactctgcttagaaaaga[T/C]gctcaaatgctctttagagaaggc
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CTV-1 (Adult T acute lymphoblastic leukemia) | 0.86 | 0.26 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder in alcoholics, ldl cholesterol change with statins, lp-pla2 activity, serum creatinine, total cholesterol change with statins