rs17041202 chr12:95623790 A>G
- Sequence
cctctagagggcgcttgagtctct[A/G]ccaaatccctgagtggcctcacca
- ASB in cell types
- HCT-116 (colon carcinoma) RH4 (alveolar rhabdomyosarcoma) K562 (myelogenous leukemia) RWPE2
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 0.21 | 1.06 | 1.30 | n/a | n/a |
Items per page:
1 – 1 of 1