rs17041204 chr12:95623902 C>T
- Sequence
tgtggagccctaattggtgttctt[C/T]agttgccaagcccaggcctaggtt
- ASB in cell types
- T47D (invasive ductal carcinoma) gastroesophageal sphincter
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 0.48 | 1.20 | 1.09 | |||
| gastroesophageal sphincter | 1.97 | -1.66 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP college completion, diastolic blood pressure (dbp), fasting blood glucose, ldl cholesterol change with statins, obesity with early age of onset (age >2), plasma aldosterone concentration corrected by plasma renin activity, total cholesterol change with statins, urinary albumin-to-creatinine ratio, years of education