rs17041843 chr3:16060601 T>C
- Sequence
tttcttcccctgtgacttggccac[T/C]gggagatgctgttgcagccacgtg
- ASB in cell types
- HMEC (human mammary epithelial cells) adrenal gland MCF10CA1a (breast metastatic epithelial cells) tibial nerve
- ASB for transcription factors
- CTCF_HUMAN STAG2_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.82 | 0.18 | 1.76 | 0.88 | Weak Discordant | |||
| STAG2_HUMAN | 2.41 | -0.27 | 1.50 | n/a | n/a | |||
| STAG1_HUMAN | 2.06 | -2.03 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP ldl cholesterol change with statins, refractive error, total cholesterol change with statins, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Breast_Mammary_Tissue, Colon_Transverse, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Muscle_Skeletal, Nerve_Tibial, Pancreas, Prostate, Testis, Thyroid