rs17085193 chr5:95858889 G>T
- Sequence
cttcaggctgctgctccatcgcat[G/T]aattccagcaggtggcgctgcacc
- ASB in cell types
- neutrophils from periferal blood WA01 (H1, human embryonic stem cells) THP-1 (acute monocytic leukemia) CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils from periferal blood | -0.69 | 1.61 | 1.50 | |||
| WA01 (H1, human embryonic stem cells) | 1.21 | -0.10 | 1.39 | |||
| THP-1 (acute monocytic leukemia) | 0.85 | 0.89 | 1.01 | |||
| CD34+ stem cells-derived erythroblasts | 2.05 | n/a | 2.00 | |||
| MM1.S (plasma cell myeloma) | 1.10 | -0.38 | 1.12 |
Items per page:
1 – 5 of 5