rs17099617 chr14:100704151 A>G
- Sequence
tggatgccagctcctgaagaccac[A/G]ggccacctgacctcttaggcgggt
- ASB in cell types
- breast tumor
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 2.22 | n/a | 2.00 | 2.30 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, alzheimers disease (apoe3 homozygotes), college completion, cystatin c in serum, ldl cholesterol, lymphocyte count, obesity with early age of onset (age >2), paternal transmission distortion, total cholesterol, transmission distortion