rs17114266 chr14:28774036 G>T
- Sequence
tttagccgggctgctccgggtcgg[G/T]tgaggcactgggtgcgtgtgggag
- ASB in cell types
- G401 (rhabdoid tumor of the kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| G401 (rhabdoid tumor of the kidney) | 2.65 | n/a | 1.00 |
Items per page:
1 – 1 of 1