rs171521 chr5:111158415 C>T
- Sequence
ttatcaagtatgttagtttgactt[C/T]ctaccagttgattttagaaatgag
- ASB in cell types
- T47D (invasive ductal carcinoma) CD34+ stem cells-derived erythroblasts THP-1 (acute monocytic leukemia) GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 0.27 | 1.49 | 2.00 | |||
| CD34+ stem cells-derived erythroblasts | 2.24 | -0.34 | 2.00 | |||
| THP-1 (acute monocytic leukemia) | 0.68 | 0.58 | 1.00 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | -0.16 | 0.52 | 1.00 | |||
| HCT-116 (colon carcinoma) | 1.34 | 1.26 | 1.00 |
Items per page:
1 – 5 of 6