rs17152281 chr7:105914076 C>A
- Sequence
ctatttgtagtgctcatgggagga[C/A]aaagaacacaaataggctcttcct
- ASB in cell types
- liver
- ASB for transcription factors
- HNF4A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HNF4A_HUMAN | 1.74 | -0.16 | 1.25 | -4.13 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, hypertriglyceridemia, infant head circumference, refractive error