rs17166546 chr7:132532442 T>C
- Sequence
agttgggaagaactagaatatggg[T/C]cacttcctctttattcttatgaaa
- ASB in cell types
- macrophages form periferal blood monocyte-derived macrophages from peripheral blood
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages form periferal blood | 2.62 | -3.33 | 2.00 | |||
| monocyte-derived macrophages from peripheral blood | 2.19 | 0.34 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP decrease in fev1 (in asthmatic participants >=30 years old), decrease in fev1 (in asthmatic participants), lung function, forced expiratory volume in 1 second (fev1) percent predicted (in asthmatic participants), rheumatoid arthritis