rs17171772 chr5:138179164 A>G
- Sequence
cagcttcggcgactaggtgtgagt[A/G]agccagtatcccaggaggagcaag
- ASB in cell types
- K562 (myelogenous leukemia) MDA-MB-231p27CK-DD (breast cancer cells, phosphimimetic p27 cell line) SUM159PT (Triple negative breast cancer) TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | 1.24 | 0.23 | 2.10 | -0.29 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid