rs172291 chr10:77413932 G>T
- Sequence
cagaaagccctgtgagtttactgg[G/T]tgtctcggctggacctacagtgct
- ASB in cell types
- T47D (invasive ductal carcinoma) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 1.02 | -0.08 | 1.62 | |||
| 22RV1 (prostate carcinoma) | 1.90 | -0.82 | 2.00 |
Items per page:
1 – 2 of 2