rs172319 chr6:129752070 C>A
- Sequence
gggaatacttagctacaattctca[C/A]gcccaatccgggctggaaagaagg
- ASB in cell types
- foreskin keratinocyte PC9 (lung adenocarcinoma) MS-1 (Small cell lung carcinoma) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 1.12 | 1.83 | |||
| PC9 (lung adenocarcinoma) | n/a | 1.97 | 4.00 | |||
| MS-1 (Small cell lung carcinoma) | 0.48 | -0.53 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | -2.06 | 2.35 | 1.50 | |||
| neutrophils | -0.94 | 1.99 | 1.50 |
Items per page:
1 – 5 of 5