rs17255175 chr14:21978361 T>G
- Sequence
ttgctcccttggatccgtggttcc[T/G]cctgttgcctctagagggcgatgt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.14 | 1.19 | 1.14 | |||
| MCF7 (Invasive ductal breast carcinoma) | -0.60 | 1.86 | 1.00 |
Items per page:
1 – 2 of 2