rs1726353 chr12:124742774 G>A
- Sequence
gtagccaggagttctcgagcagcc[G/A]gagagcgatggatttccaccggca
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | n/a | 2.19 | 1.00 | 2.04 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP body mass index (bmi), hip bone mineral density (bmd), infant head circumference, ldl cholesterol change with statins, obesity (body mass index (bmi)), stabilized warfarin dose