rs17281778 chr10:2939044 T>C
- Sequence
gtcattctgaggaatacatgaaaa[T/C]tctgtagtcagatcttggaaaatg
- ASB in cell types
- A549 (lung carcinoma) MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | -0.15 | 0.87 | 2.00 | |||
| MS-1 (Small cell lung carcinoma) | 0.97 | -0.51 | 1.00 |
Items per page:
1 – 2 of 2