rs17352376 chr9:34413422 G>A
- Sequence
gatccagtcccgaggatgaaaggc[G/A]ctctccgtggtgctgaacaatctt
- ASB in cell types
- HepG2 (hepatoblastoma) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- REST_HUMAN ZSC9_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| REST_HUMAN | 1.39 | 0.05 | 1.31 | -3.65 | Concordant | |||
| ZSC9_HUMAN | 2.67 | -2.54 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP adiponectin levels, aortic valve calcium, college completion, height, infant head circumference, triglycerides, years of education
GTEx eQTL Artery_Tibial, Brain_Nucleus_accumbens_basal_ganglia, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood