rs173589 chr16:11195114 C>G
- Sequence
gcacaacccacagcccctcctccc[C/G]ctcacaccatttcctcccttctgc
- ASB in cell types
- Th1-cells
- ASB for transcription factors
- TBX21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TBX21_HUMAN | 2.00 | 0.13 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Lung, Skin_Not_Sun_Exposed_Suprapubic, Thyroid