rs17359906 chr1:173867056 G>A
- Sequence
ccagcaccatacctaaagagatca[G/A]gtacagattttaattcattgttcc
- ASB in cell types
- MV-4-11 (Childhood acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MV-4-11 (Childhood acute monocytic leukemia) | -2.00 | 2.37 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cortex, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Small_Intestine_Terminal_Ileum, Thyroid