rs17369102 chr1:179366003 A>G
- Sequence
gaagtgagcggatgctgggcgggt[A/G]cgcaatgtgtgggtaggatcgcgg
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) HCT-116 (colon carcinoma) adult erythroblasts macrophages form periferal blood
- ASB for transcription factors
- CTCF_HUMAN SPI1_HUMAN HCFC1_HUMAN CBX3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.60 | 0.01 | 1.52 | n/a | No Hit | |||
| SPI1_HUMAN | 1.40 | 0.41 | 1.30 | n/a | No Hit | |||
| HCFC1_HUMAN | 2.37 | 0.74 | 2.00 | n/a | n/a | |||
| CBX3_HUMAN | 2.65 | n/a | 1.00 | n/a | n/a | |||
| STAT3_HUMAN | 1.79 | -0.34 | 1.62 | n/a | No Hit |
Items per page:
1 – 5 of 6
Motif analysis
Genetic associations
GRASP ldl cholesterol change with statins, total cholesterol change with statins, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Substantia_nigra, Breast_Mammary_Tissue, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Heart_Atrial_Appendage, Kidney_Cortex, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood