rs17376459 chr8:27405657 A>G
- Sequence
cccacacagacacctacagaggcc[A/G]gcacaaggtagacacgcaggttcc
- ASB in cell types
- naive IgD+ B cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| naive IgD+ B cells | 2.10 | -1.05 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, aortic valve calcium, college completion, fasting insulin, homa-b, homa-ir, ldl cholesterol, ldl cholesterol change with statins, nicotine dependence (smoking), cigarettes per day, total cholesterol change with statins
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle