rs17425308 chr1:47876221 G>A
- Sequence
ctcagttcagtcaactcaagtggg[G/A]agcataaccctgagatcacagggc
- ASB in cell types
- SMMC-7721 (hepatocellular carcinoma)
- ASB for transcription factors
- PBX3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PBX3_HUMAN | -2.11 | 2.60 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), birth weight, diastolic blood pressure (dbp), waist hip ratio