rs174678 chr22:19947113 G>A
- Sequence
tatttttagtagagatggggtttc[G/A]ccacactggccaggctggtcttga
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ARI1B_HUMAN ZEB2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ARI1B_HUMAN | 2.13 | n/a | 4.00 | n/a | n/a | |||
| ZEB2_HUMAN | 2.32 | n/a | 4.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Heart_Atrial_Appendage, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Testis