rs1750570 chr6:43924498 C>T
- Sequence
cttcagacggtgttccttctgtcg[C/T]ccagcctgtggtcgccctggccgg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MOLM14 (Adult acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 1.09 | 0.33 | 1.12 | |||
| MOLM14 (Adult acute myeloid leukemia) | 0.22 | 1.77 | 2.00 |
Items per page:
1 – 2 of 2