rs17515708 chr2:112645686 G>A
- Sequence
gtaatcagccggcggggccagacg[G/A]tgccgagactccagggcgaggccg
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) UCLA1 hESCs LNCaP (prostate carcinoma)
- ASB for transcription factors
- AP2C_HUMAN TBP_HUMAN BRD4_HUMAN ZN467_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| AP2C_HUMAN | -3.17 | 3.03 | 1.00 | n/a | No Hit | |||
| TBP_HUMAN | 0.00 | 1.73 | 2.00 | n/a | No Hit | |||
| BRD4_HUMAN | 0.05 | 1.08 | 1.58 | n/a | n/a | |||
| ZN467_HUMAN | n/a | 2.30 | 1.00 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Thyroid