rs175168 chr22:20129383 C>T
- Sequence
gtccccagcagtgagaaggcccct[C/T]ggaatggctgggagacagtgccat
- ASB in cell types
- MDA-MB-453 (breast adenocarcinoma)
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | -4.41 | 1.94 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellum, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Nerve_Tibial, Spleen