rs177264 chr1:54488282 T>C
- Sequence
cctggggcggcgctgggggggcgg[T/C]gtcggcccgggcagcagcctccgc
- ASB in cell types
- neural cell thymus-derived CD34- cells breast tumor
- ASB for transcription factors
- BC11B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BC11B_HUMAN | -2.00 | 2.94 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1