rs1778882 chr10:34185226 C>T
- Sequence
ctgtctttatctctgttatttgca[C/T]ttcaaacctggaaaaacagttgag
- ASB in cell types
- HepG2 (hepatoblastoma) HS-SY-2(Monophasic synovial sarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.96 | 0.09 | 1.16 | |||
| HS-SY-2(Monophasic synovial sarcoma) | 0.53 | 2.38 | 2.75 |
Items per page:
1 – 2 of 2