rs178003 chr18:22504793 G>A
- Sequence
tttaggacaaggaaaagaactcag[G/A]attgcaaactgctagtctgaacta
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- ZN660_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN660_HUMAN | -4.09 | 2.48 | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP irritible bowel syndrome, ldl cholesterol, tardive dyskinesia, urinary albumin-to-creatinine ratio