rs178004 chr18:22504854 T>C
- Sequence
ttattatctgagtcactcatgtag[T/C]catcctgggaggtattaggaacac
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- ZN660_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN660_HUMAN | 2.98 | n/a | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), urinary albumin-to-creatinine ratio