rs17841809 chr16:23324745 A>G
- Sequence
atctttcaaggcttggcagaaact[A/G]ccctctccaagttgcctccagcat
- ASB in cell types
- breast tumor
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 2.95 | 0.20 | 2.67 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cognitive response of healthy volunteers to topiramate treatment as measure by the digit symbol cognitive test, diastolic blood pressure (dbp), hdl cholesterol, ldl cholesterol