rs1788355 chr21:42010890 G>T
- Sequence
cgacagcgacgggagcgacgcgcg[G/T]ctttctgacgggcgcgggcggcga
- ASB in cell types
- K562 (myelogenous leukemia) neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.55 | 0.86 | 1.13 | |||
| neural cell | 0.48 | 1.45 | 1.00 |
Items per page:
1 – 2 of 2