rs179456 chr8:115682885 G>A
- Sequence
aagtggttgagttacatgagttag[G/A]ttacattgcattaggttgtcagag
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.07 | 0.84 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting proinsulin levels in non-diabetics, ldl cholesterol, liver expression of trps1, partial epilepsy, total cholesterol