rs1800469 chr19:41354391 A>G
- Sequence
aggagggggcaacaggacacctga[A/G]ggatggaagggtcaggaggcagac
- ASB in cell types
- pancreas ID00014 (lymphoblastoid cell, DiGeorge syndrome) neutrophils from periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| pancreas | 2.42 | -2.16 | 1.00 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | 2.36 | -2.38 | 1.00 | |||
| neutrophils from periferal blood | 2.48 | n/a | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, cystatin c in serum, height, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Spleen, Testis