rs1810503 chr20:50440872 A>T
- Sequence
tctccatgcctttggacccaggac[A/T]gcttccccacatcctttaaaacga
- ASB in cell types
- HepG2 (hepatoblastoma) HASM2 (Human airway smooth muscle 2) MCF7 (Invasive ductal breast carcinoma) HT29 (colon adenocarcinoma)
- ASB for transcription factors
- GCR_HUMAN ESR1_HUMAN TCF21_HUMAN PPARG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 2.14 | -0.42 | 1.12 | n/a | No Hit | |||
| ESR1_HUMAN | 2.26 | -0.12 | 2.38 | -3.20 | Concordant | |||
| TCF21_HUMAN | 1.33 | n/a | 3.00 | n/a | n/a | |||
| PPARG_HUMAN | 1.77 | -0.24 | 1.75 | n/a | No Hit | |||
| NR1H3_HUMAN | 2.34 | -1.66 | 1.50 | n/a | No Hit |
Items per page:
1 – 5 of 13
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, college completion, fasting blood glucose, ldl cholesterol, major depressive disorder (broad definition), major depressive disorder (broad definition) (females), years of education