rs182086 chr5:179906702 T>C
- Sequence
aagctgaagggaacactgagtgtt[T/C]ctgggaacagaacagtctcttcca
- ASB in cell types
- VCaP (prostate carcinoma) LHSAR (prostate epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | 1.97 | -0.22 | 2.09 | |||
| LHSAR (prostate epithelial cells) | -0.19 | 1.20 | 1.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood