rs182420 chr19:47868938 C>T
- Sequence
tgtgggtttttattgttgctactt[C/T]gagatgcagttgtatctctagaga
- ASB in cell types
- OCI-LY7 (diffuse large B-cell lymphoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.65 | 1.04 | 1.25 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP breast cancer, ldl cholesterol, ldl cholesterol change with statins, serum dehydroepiandrosterone sulphate (dheas), serum dehydroepiandrosterone sulphate (dheas) (females), total cholesterol, total cholesterol change with statins, triglycerides