rs182899 chr5:69048351 G>A
- Sequence
ttggcatttgccctgcctaaattc[G/A]gggtggattgtgttgtattatatc
- ASB in cell types
- foreskin keratinocyte K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -4.75 | 1.82 | 2.67 | |||
| K562 (myelogenous leukemia) | 0.72 | 0.01 | 1.99 |
Items per page:
1 – 2 of 2