rs183387278 chr5:36646841 G>T
- Sequence
tagtacccacaaataatgttcaaa[G/T]agctatttttgaggaaaggattcc
- ASB in cell types
- HEK293-A
- ASB for transcription factors
- MEF2B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEF2B_HUMAN | 1.70 | -0.55 | 1.50 | 0.96 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
